Background: DNA Barcoding Explained
Before you investigate this wildlife trafficking case, it's important to understand the forensic method that will help you solve it: DNA barcoding.
How This Helps Your Investigation
In this investigation, you'll use DNA barcoding to compare the mystery evidence samples against known species in scientific databases. If the DNA sequence matches a protected or endangered species, that's evidence of wildlife trafficking!
Investigation Video Introduction
Case Summary
Operation Type
Wildlife Trafficking Investigation
Background
Wildlife Conservation Officers have been investigating a sophisticated wildlife trafficking ring. An anonymous tip led to surveillance of three suspects. During a coordinated operation on November 2024, officers:
- Stopped a vehicle driven by Suspect A
- Collected evidence from Suspect B's clothing during questioning
- Executed a search warrant at Suspect C's business location
Three biological samples were recovered and sent to the forensics lab for DNA analysis. Your mission: Use DNA barcoding to identify the species and determine which suspect(s) are involved in illegal wildlife trafficking.
📋 YOUR MISSION
Use DNA barcoding tools (NCBI BLAST or BOLD Systems) to:
- Identify the species from each DNA sequence
- Determine if the species are protected/endangered
- Evaluate each suspect's statement against the evidence
- Determine which suspect(s) are guilty of wildlife trafficking
Physical Evidence
Location Recovered: Vehicle trunk during traffic stop
Description: Small piece of tissue wrapped in plastic, approximately 2cm × 2cm, reddish-brown in color
Students must identify using DNA barcoding
DNA Sequence (COI gene):
AACCCTTTACCTTCTATTTGGCGCCTGGGCCGGTATGGTAGGGACTGCTCTCAGTCTCTTAATCCGAGCCGAACTGGGTCAACCTGGCACGCTACTAGGGGACGACCAAATTTATAATGTAGTCGTCACCGCCCATGCCTTTGTAATAATCTTCTTTATGTAATGCCTATTATGATTGGAGTTCGGAAACTGATTGGTTCCATTAATAATTGGAGCCCCCGATATAGCATTCCCTCGAATGAATAATATGAGCGTCTGACTCCTTCCCCCGTCTTTCCTACTTTTGCTCGCATCATCTATGGTAGAGGCTGGAGCAGGGACTGGATGGACAGTATACCCACCTCTAGCCGGCAAGCTAGCTCATGCAGGACCGTCCGTAGATCTAACTATTTTTTCACTACACCTAGCAGGTGTCTCCTCAATCTTAGTGCTATTAATTTTATTACTACTATCATTAATATAACCCCCTGCTATATCCCAATATAAACACCCCTATTTGTCTGATCGGTTTTAATCAGCTGTATTGCTACTTCTATCACTACCAGTTTTAGCAGCAGGCATCACTATACTACTGACAGATCGAAATCTGAACACCACATTTTTTGACCCCCGCCGGAGGAGGGGATCCTATCTTACTTATATCAACACCTATTC
Length: ~650 bp | BLAST Identity: 98-100% | E-value: 0.0
Location Recovered: Stain on jacket during suspect interview
Description: Dried blood stain on jacket sleeve, approximately 3cm in diameter, dark brown coloration
Students must identify using DNA barcoding
DNA Sequence (COI gene):
AACTCTTTACCTTCTATTTGGTGCCTGGGCTGGCCTGGTGGGGACTGCTCTCAGTCTCTTAATCCGAGCCGAACTGGGTCAACCTGGCACACTGCTAGGGGACGACCAAACTTATAATGTAGTCGTTACCGCCCTGCTTTTGTAATAATCTTCTTTATAGTAATGCCCATCATGATTGGAGGATTCAGAAACTGTGGTCCCATTAATAATTGGAGCCCCCGATATAGCATTCCCTCGAATGAATAATATGAGCTTCTGACTCCCCCCGTCTTTCCTACTTTTGCTCGCATCATCTATGGTAGACGCTGGAGCAGGGACTGGAGGACAGTACACCCACCTCTAGCCGCCAACCTAGCTCATGCAGGAGCATCCGTAGATCTAACTATTTTTTCACTACACCTGGCAGGTGACTCCTCAATCTTAGCGCTATTAATTTTATTACTACTATTATTAATATAAAACCCCCTGCTATATCCCAATACCAAACACCTCTATTCGTCTGATCGGTCTTAATCACTGCTGTATTGCTACTCCTATACTGCCAGTTTTAGCAGCAGGCATCACTATGCTACTGACAGATCGAAATCTGAACACCACATTCTTTGACCCTGCCGGAGGGGCGGATCCTATCTTATACCAGCACCTATTC
Length: ~650 bp | BLAST Identity: 97-100% | E-value: 0.0
Location Recovered: Storage container at warehouse
Description: Multiple coarse hair strands, gray to black in color, approximately 5-8cm length
Students must identify using DNA barcoding
DNA Sequence (COI gene):
AACACTGTATCTACTATTTGGTGCTTGAGCTGCTATAGTAGGGACTGCTTTTAGTATTCTAATTCCGGCAGAATTAGGTCAACCAGGCTCTCTTCTTGGAGACGACCAAATCTATAATGTCATTGTCACAGCACACGCCTTTGTAATAATCTTCTTTATGGTTATGCCAATCATAATTGGAGGCTTTGGAAACTGGTTAATTCCACTTATAATTGGAGCACCTGATATAGCTTTTCCTCGAAGAAACAATATAAGTTTCTGACTACTGCCTCCGTCCTTCCTACTACTTTTGGCATCCTCCATAGTAGAAGCTGGAACAGGCACTGGTTGGACCGTATATCCTCCTCTGGCAGGAAACTTAGCTCATGCAGGAGCTTCTGTAGATTTAACTATTTTTTCACTTCACCTTGCAGGAGTATCCTCTATTCTAAGTGCAATTAATTTTATCACTACCATCATCAACATAAAACCCCCAGCCATGTCTCAATATCATATACCCTTATTTGTATGATCCATTTTAGTTACAGCCGTTCTTCTTCTTCTATCTCTCCCAGTTCTAGCAGCAGGTATTACAATACTATTAACGGATCGCAATCTCAATACTACTTTCTTTGAACCTGCAGGAGGAGGAGACCCAGTTCTATACCAACACCTATTC
Length: ~650 bp | BLAST Identity: 98-100% | E-value: 0.0
Suspect Profiles
Travis (just Travis)
Statement:
"I know it's an odd combination but I only sell vintage furniture and legal domesticated animals like parrots, lizards, and snakes. The tissue found in my vehicle is from chicken I purchased at the grocery store to feed my personal pet python. I have receipts. I was at my store the entire day."
Alibi: Claims to have been working at store; security footage being reviewed
Prior Record: One citation 5 years ago for selling animals without proper permits (paid fine)
Evidence Linked: CS-2024-047-A
Kole Kwinton
Statement:
"Dude, I just turned 25 last week—had an epic birthday party. Being from B.C., I'm way more aware of nature than you Ontario people. I'd never hurt animals. Any blood on my jacket is from a minor cut I got while hiking. This is ridiculous!"
Alibi: Claims to have been at remote field site; no witnesses
Prior Record: Recently posted controversial content featuring exotic animals in compromising situations. Online followers questioned ethics of content production.
Evidence Linked: CS-2024-047-B
Morgan Li
Statement:
"My company imports legal goods including textiles, electronics, and furniture. The warehouse stores only manufactured products, nothing biological. I was at my office during the time in question and have employee witnesses."
Alibi: Multiple employees confirm presence at office
Prior Record: Company investigated 2 years ago for customs violations (no charges filed)
Evidence Linked: CS-2024-047-C